Top » Catalog » R1b » A181

$18.00

A181
[A181]

A181
hg38 Position: ChrY:14766288..14766288
Ancestral: T
Derived: C
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Found in a R1b-FGC5496/S1088 person.
Forward Primer: A181_F TTAGTATGTCAGTGAAGGGAAATCTG
Reverse Primer: A181_R TGTGAATGTTGTACTTCACTGTGG
Reviews

Customers who bought this product also purchased
A183
A183
A164
A164
A170
A170
A188
A188
A175
A175
A193
A193
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies