Top » Catalog » R1b » A181

$18.00

A181
[A181]

A181
hg38 Position: ChrY:14766288..14766288
Ancestral: T
Derived: C
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Found in a R1b-FGC5496/S1088 person.
Forward Primer: A181_F TTAGTATGTCAGTGAAGGGAAATCTG
Reverse Primer: A181_R TGTGAATGTTGTACTTCACTGTGG
Reviews

Customers who bought this product also purchased
A179
A179
A162
A162
A186
A186
A167
A167
A191
A191
A173
A173
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies