Top » Catalog » R1b » A183

$19.00

A183
[A183]

A183
hg38 Position: ChrY:15041165..15041165
Ancestral: G
Derived: A
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1l2~
Comments: Found in a R1b-FGC5496/S1088 person.
Forward Primer: A183_F TGTGTTCAGCATTCACAAATC
Reverse Primer: A183_R CAGATTGCAAGGAAAGAGAGG
Reviews

Customers who bought this product also purchased
A173
A173
A191
A191
A178
A178
A166
A166
A185
A185
A172
A172
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies