Top » Catalog » R1b » A183

$18.00

A183
[A183]

A183
hg38 Position: ChrY:15041165..15041165
Ancestral: G
Derived: A
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1l2~
Comments: Found in a R1b-FGC5496/S1088 person.
Forward Primer: A183_F TGTGTTCAGCATTCACAAATC
Reverse Primer: A183_R CAGATTGCAAGGAAAGAGAGG
Reviews

Customers who bought this product also purchased
A163
A163
A180
A180
A169
A169
A187
A187
A174
A174
A192
A192
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies