Top » Catalog » R1b » A183

$18.00

A183
[A183]

A183
hg38 Position: ChrY:15041165..15041165
Ancestral: G
Derived: A
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1l2~
Comments: Found in a R1b-FGC5496/S1088 person.
Forward Primer: A183_F TGTGTTCAGCATTCACAAATC
Reverse Primer: A183_R CAGATTGCAAGGAAAGAGAGG
Reviews

Customers who bought this product also purchased
A162
A162
A179
A179
A167
A167
A186
A186
A173
A173
A191
A191
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies