Top » Catalog » R1b » A184

$18.00

A184
[A184]

A184
hg38 Position: ChrY:15278647..15278647
Ancestral: C
Derived: T
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Found in a R1b-FGC5496/S1088 person.
Forward Primer: A184_F TTGCACCAGAGCAAGAACTG
Reverse Primer: A184_R GACTGGGGCAGAAGGAATC
Reviews

Customers who bought this product also purchased
A176
A176
CTS2085
CTS2085
A164
A164
A181
A181
A170
A170
A188
A188
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies