Top » Catalog » R1b » A186

$18.00

A186
[A186]

A186
hg38 Position: ChrY:16463874..16463874
Ancestral: C
Derived: T
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Found in a R1b-FGC5496/S1088 person.
Forward Primer: A186_F TTCTAATTGCCTTTGCCTCTC
Reverse Primer: A186_R CACCATTTTCATGGCAGTTG
Reviews

Customers who bought this product also purchased
A166
A166
A184
A184
A172
A172
A190
A190
A177
A177
M3668
M3668
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A14645
1 x A20817
1 x A19334
1 x A19281
1 x A19277
1 x A13641
1 x A15553
1 x A17831
1 x A12925
1 x A14644
1 x A13647
1 x A18932
1 x A19279
1 x A20820
1 x A19274
1 x A18468
1 x A15547
1 x A12921
1 x A15548
1 x A13649
1 x A18931
1 x A19931
1 x A17372
1 x A13639
1 x A12919
1 x A19275
1 x A10970
1 x A13645
1 x A14648
1 x A18555
1 x A19336
1 x A20954
1 x A13638
1 x A19929
1 x A18940
1 x A14641
1 x A15551
1 x A17833
1 x A19335
1 x A13637
1 x A18939
1 x A14639
1 x A12918
1 x A19218
1 x A16982
1 x A19280
1 x A19263
1 x A21955
1 x A15550
1 x A18554
1 x A13633
1 x A13635
1 x A13650
$954.00
Haplogroup Info
Other products
Currencies