Top » Catalog » R1b » A186

$18.00

A186
[A186]

A186
hg38 Position: ChrY:16463874..16463874
Ancestral: C
Derived: T
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Found in a R1b-FGC5496/S1088 person.
Forward Primer: A186_F TTCTAATTGCCTTTGCCTCTC
Reverse Primer: A186_R CACCATTTTCATGGCAGTTG
Reviews

Customers who bought this product also purchased
A167
A167
A185
A185
A173
A173
A191
A191
A178
A178
A166
A166
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies