Top » Catalog » R1b » A187

$18.00

A187
[A187]

A187
hg38 Position: ChrY:18665896..18665896
Ancestral: C
Derived: T
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1l2~
Comments: Found in a R1b-FGC5496/S1088 person.
Forward Primer: A187_F ATCTAAGGGGTGGCTGGAAC
Reverse Primer: A187_R CTCCCCCACACTTTGTATCC
Reviews

Customers who bought this product also purchased
A177
A177
M3668
M3668
A165
A165
A183
A183
A171
A171
A189
A189
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies