Top » Catalog » R1b » A187

$18.00

A187
[A187]

A187
hg38 Position: ChrY:18665896..18665896
Ancestral: C
Derived: T
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1l2~
Comments: Found in a R1b-FGC5496/S1088 person.
Forward Primer: A187_F ATCTAAGGGGTGGCTGGAAC
Reverse Primer: A187_R CTCCCCCACACTTTGTATCC
Reviews

Customers who bought this product also purchased
A173
A173
A191
A191
A178
A178
A166
A166
A184
A184
A172
A172
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A97
1 x A48
1 x A120
1 x A14
1 x A47
1 x A119
1 x A95
1 x A155
1 x A94
1 x A93
1 x A136
1 x A101
1 x A92
1 x A135
1 x A43
1 x A60
1 x A3
1 x A133
1 x A162
1 x A151
1 x A81
1 x A146
1 x A132
1 x A167
1 x A33
1 x A6
1 x A58
1 x A99
1 x A131
1 x A149
1 x A77
1 x A109
1 x A163
1 x A179
1 x A57
$630.00
Haplogroup Info
Other products
Currencies