Top » Catalog » R1b » A187

$18.00

A187
[A187]

A187
hg38 Position: ChrY:18665896..18665896
Ancestral: C
Derived: T
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1l2~
Comments: Found in a R1b-FGC5496/S1088 person.
Forward Primer: A187_F ATCTAAGGGGTGGCTGGAAC
Reverse Primer: A187_R CTCCCCCACACTTTGTATCC
Reviews

Customers who bought this product also purchased
A186
A186
A169
A169
A192
A192
A174
A174
A162
A162
A179
A179
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies