Top » Catalog » R1b » A189

$18.00

A189
[A189]

A189
hg38 Position: ChrY:19537540..19537540
Ancestral: G
Derived: A
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1l2~
Comments: Found in a R1b-FGC5496/S1088 person.
Forward Primer: A189_F TCACCATGTTGGCTATGAGG
Reverse Primer: A189_R TTTTGGTGAGGTGTCTCTTCAG
Reviews

Customers who bought this product also purchased
A171
A171
A188
A188
A176
A176
CTS2085
CTS2085
A164
A164
A181
A181
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies