Top » Catalog » R1b » A190

$18.00

A190
[A190]

A190
hg38 Position: ChrY:19745292..19745292
Ancestral: G
Derived: C
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Found in a R1b-FGC5496/S1088 person.
Forward Primer: A190_F GGCGATATCCGTTCATGTG
Reverse Primer: A190_R AGGGGGATTTTTGCTTAACG
Reviews

Customers who bought this product also purchased
CTS2085
CTS2085
A176
A176
A164
A164
A181
A181
A187
A187
A170
A170
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies