Top » Catalog » R1b » A190

$18.00

A190
[A190]

A190
hg38 Position: ChrY:19745292..19745292
Ancestral: G
Derived: C
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Found in a R1b-FGC5496/S1088 person.
Forward Primer: A190_F GGCGATATCCGTTCATGTG
Reverse Primer: A190_R AGGGGGATTTTTGCTTAACG
Reviews

Customers who bought this product also purchased
A192
A192
A174
A174
A162
A162
A179
A179
A167
A167
A185
A185
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies