Top » Catalog » R1b » A190

$18.00

A190
[A190]

A190
hg38 Position: ChrY:19745292..19745292
Ancestral: G
Derived: C
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Found in a R1b-FGC5496/S1088 person.
Forward Primer: A190_F GGCGATATCCGTTCATGTG
Reverse Primer: A190_R AGGGGGATTTTTGCTTAACG
Reviews

Customers who bought this product also purchased
A191
A191
A173
A173
A178
A178
A184
A184
A166
A166
A189
A189
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies