Top » Catalog » R1b » A191

$18.00

A191
[A191]

A191
hg38 Position: ChrY:19746641..19746641
Ancestral: T
Derived: G
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1l2~
Comments: Found in a R1b-FGC5496/S1088 person.
Forward Primer: A191_F TTCGTAAGGTTGTTGGCTTG
Reverse Primer: A191_R GGGACAACTAGATGGCAACAC
Reviews

Customers who bought this product also purchased
A173
A173
A190
A190
A178
A178
A166
A166
A184
A184
A172
A172
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies