Top » Catalog » R1b » A193

$18.00

A193
[A193]

A193
hg38 Position: ChrY:8031226..8031226
Ancestral: G
Derived: A
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1l2~
Comments: Found in a R1b-FGC5496/S1088 person.
Forward Primer: A193_F TCTGAGCTCTGTCAACAGGAAGT
Reverse Primer: A193_R CTGTCTGTATAACCCAAAGACCTTCT
Reviews

Customers who bought this product also purchased
A700
A700
A194
A194
A163
A163
A180
A180
A169
A169
A186
A186
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies