Top » Catalog » R1b » A194

$18.00

A194
[A194]

A194
hg38 Position: ChrY:9299121..9299121
Ancestral: G
Derived: A
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1l2~
Comments: Found in a R1b-FGC5496/S1088 person.
Forward Primer: A194_F TATATATATATATGCTAAAGCTTCATCCTTGT
Reverse Primer: A194_R GGACTCTGACTATGAAATCCTCAGA
Reviews

Customers who bought this product also purchased
Z253
Z253
S1088
S1088
L21
L21
Z251
Z251
FGC5521
FGC5521
DF27
DF27
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1142
1 x A798
1 x A955
$54.00
Haplogroup Info
Other products
Currencies