Top » Catalog » R1b » A194

$18.00

A194
[A194]

A194
hg38 Position: ChrY:9299121..9299121
Ancestral: G
Derived: A
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1l2~
Comments: Found in a R1b-FGC5496/S1088 person.
Forward Primer: A194_F TATATATATATATGCTAAAGCTTCATCCTTGT
Reverse Primer: A194_R GGACTCTGACTATGAAATCCTCAGA
Reviews

Customers who bought this product also purchased
Z39589
Z39589
FGC11134
FGC11134
L513
L513
S1105
S1105
MC14
MC14
FGC5496
FGC5496
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies