Top » Catalog » R1b » A225

$18.00

A225
[A225]

A225
hg38 Position: ChrY:17193773..17193773
Ancestral: G
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a2c1a1a1a1~
Comments: R1b-M222/S660
Forward Primer: A225_F GAAGATGCATCAGTGCCAAG
Reverse Primer: A225_R GCAGTCTGGCTCATCCTTTC
Reviews

Customers who bought this product also purchased
S659
S659
M222
M222
S588
S588
DF49
DF49
S7050
S7050
A738
A738
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A760
1 x A985
$36.00
Haplogroup Info
Other products
Currencies