Top » Catalog » R1b » A226

$18.00

A226
[A226]

A226
hg38 Position: ChrY:15892808..15892808
Ancestral: A
Derived: G
Reference: Joe Fox (2014)
ISOGG Haplogroup: R1b1a1a2a1a1c1a2a2
Comments: Approx. R-L1/R-S26
Forward Primer: A226_F TTTTGATGGGGGTATCATGG
Reverse Primer: A226_R CTGCCAACTCAGAGAAATGTTG
Reviews

Customers who bought this product also purchased
S6961
S6961
L1
L1
S11515
S11515
DF96
DF96
R1b-U106 Superclade Panel
R1b-U106 Superclade Panel
A317
A317
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies