Top » Catalog » R1b » A227

$18.00

A227
[A227]

A227
hg38 Position: ChrY:13505249..13505249
Ancestral: C
Derived: T
Reference: Joe Fox (2014)
ISOGG Haplogroup: R1b1a1a2a1a1c1a2a2
Comments: Approx. R-L1/R-S26
Forward Primer: A227_F TCATCAACCAAGAATTTTATGTCC
Reverse Primer: A227_R TGTGAGCCTGCTGAAAACAG
Reviews

Customers who bought this product also purchased
S1791
S1791
A226
A226
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies