Top » Catalog » R1b » A228

$18.00

A228
[A228]

A228
hg38 Position: ChrY:15703461..15703461
Ancestral: C
Derived: T
Reference: A. P. (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c~
Comments: Downstream R1b-Z251
Forward Primer: A228v2_F GCTGGCTCAGAGGATAGGTG
Reverse Primer: A228v2_R ATGAAAGATTTCATAGTCAAAATGTATG
Reviews

Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A100
1 x A2075
1 x A165
1 x A967
1 x A517
1 x A1096
1 x A976
1 x A360
1 x A495
1 x A338
1 x A725
1 x A977
$216.00
Haplogroup Info
Other products
Currencies