Top » Catalog » R1b » A229

$18.00

A229
[A229]

A229
hg38 Position: ChrY:19712240..19712240
Ancestral: T
Derived: C
Reference: A. P. (2014)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Downstream R1b-Z251
Forward Primer: A229_F GGACCCATCCTCCAAATAGG
Reverse Primer: A229_R CGATGTCAGCAGGTGATAGG
Reviews

Customers who bought this product also purchased
A252
A252
FGC13909
FGC13909
A245
A245
A251
A251
A256
A256
A244
A244
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A342
1 x A1080
1 x A694
1 x A2170
1 x A7
1 x A1766
1 x A1141
1 x A570
1 x A2071
1 x A683
1 x A2146
1 x A554
1 x A970
1 x A680
1 x A191
1 x A185
1 x A463
$306.00
Haplogroup Info
Other products
Currencies