Top » Catalog » R1b » A230

$18.00

A230
[A230]

A230
hg38 Position: ChrY:19912016..19912016
Ancestral: C
Derived: G
Reference: A. P. (2014)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Below Z251 > A239
Forward Primer: A230_F TGTTTCTCTGGCATGGAGTG
Reverse Primer: A230_R CAGGCAAGAGGGAGAAAGAG
Reviews

Customers who bought this product also purchased
FGC13909
FGC13909
A245
A245
A251
A251
A256
A256
A244
A244
A250
A250
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A247
1 x A315
1 x A1504
1 x A353
1 x A593
1 x A172
1 x A730
$126.00
Haplogroup Info
Other products
Currencies