Top » Catalog » R1b » A230

$18.00

A230
[A230]

A230
hg38 Position: ChrY:19912016..19912016
Ancestral: C
Derived: G
Reference: A. P. (2014)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Below Z251 > A239
Forward Primer: A230_F TGTTTCTCTGGCATGGAGTG
Reverse Primer: A230_R CAGGCAAGAGGGAGAAAGAG
Reviews

Customers who bought this product also purchased
A253
A253
R1b-Z251 downstream 24
R1b-Z251 downstream 24
FGC13933
FGC13933
A246
A246
A252
A252
FGC13909
FGC13909
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A164
$18.00
Haplogroup Info
Other products
Currencies