Top » Catalog » R1b » A230

$18.00

A230
[A230]

A230
hg38 Position: ChrY:19912016..19912016
Ancestral: C
Derived: G
Reference: A. P. (2014)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Below Z251 > A239
Forward Primer: A230_F TGTTTCTCTGGCATGGAGTG
Reverse Primer: A230_R CAGGCAAGAGGGAGAAAGAG
Reviews

Customers who bought this product also purchased
A243
A243
A248
A248
A254
A254
A242
A242
Z251
Z251
A247
A247
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A592
1 x A1174
1 x A33
1 x A2132
1 x A1171
1 x A171
1 x A1292
1 x A1339
1 x A2121
1 x A2123
1 x A2151
1 x A2197
1 x A1782
1 x A637
1 x A859
1 x A247
1 x A2125
1 x A505
1 x A309
$342.00
Haplogroup Info
Other products
Currencies