Top » Catalog » R1b » A232

$18.00

A232
[A232]

A232
hg38 Position: ChrY:21218493..21218493
Ancestral: C
Derived: T
Reference: A. P. (2014)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Downstream R1b-Z251
Forward Primer: A232v2_F AAAGAGCCAAGCAGCATTTTAG
Reverse Primer: A232v2_R CAGGTGCAGTGGTTCATGTG
Reviews

Customers who bought this product also purchased
A243
A243
A248
A248
A254
A254
A242
A242
Z251
Z251
A247
A247
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies