Top » Catalog » R1b » A235

$18.00

A235
[A235]

A235
hg38 Position: ChrY:8320679..8320679
Ancestral: G
Derived: A
Reference: A. P. (2014)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Downstream R1b-Z251
Forward Primer: A235_F AGGCATTATGACATATTATTTGAGAC
Reverse Primer: A235_R TGCCTCATTGGTAGGCTCTG
Reviews

Customers who bought this product also purchased
A976
A976
A975
A975
A959
A959
A980
A980
A958
A958
A979
A979
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A687
1 x A1343
1 x A1504
1 x A807
1 x A593
1 x A564
1 x A2233
1 x A340
1 x A1265
1 x A1191
1 x A420
1 x A735
1 x A172
1 x A508
1 x A2223
1 x A235
1 x A59
1 x A385
1 x A1290
1 x A661
1 x A2225
1 x A1242
1 x A1236
1 x A498
$432.00
Haplogroup Info
Other products
Currencies