Top » Catalog » R1b » A236

$18.00

A236
[A236]

A236
hg38 Position: ChrY:14216533..14216533
Ancestral: C
Derived: T
Reference: A. P. (2014)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Downstream R1b-Z251
Forward Primer: A236v2_F AACTTATGTGATTACCATCTCCTGG
Reverse Primer: A236v2_R GATGTACTCTGTGTAACCACGCA
Reviews

Customers who bought this product also purchased
A959
A959
A980
A980
A958
A958
A979
A979
A977
A977
A976
A976
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies