Top » Catalog » R1b » A237

$18.00

A237
[A237]

A237
hg38 Position: ChrY:12053405..12053405
Ancestral: A
Derived: G
Reference: A. P. (2014)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Downstream R1b-Z251
Forward Primer: A237_F ATTTTCTCTTGCGGGGTATG
Reverse Primer: A237_R AGTTTCTCTCCCCCAACTCAG
Reviews

Customers who bought this product also purchased
Z253
Z253
Z255
Z255
DF49
DF49
L1335
L1335
DF13
DF13
FGC11134
FGC11134
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2210
1 x A974
1 x A555
$54.00
Haplogroup Info
Other products
Currencies