Top » Catalog » R1b » A237

$18.00

A237
[A237]

A237
hg38 Position: ChrY:12053405..12053405
Ancestral: A
Derived: G
Reference: A. P. (2014)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Downstream R1b-Z251
Forward Primer: A237_F ATTTTCTCTTGCGGGGTATG
Reverse Primer: A237_R AGTTTCTCTCCCCCAACTCAG
Reviews

Customers who bought this product also purchased
FGC11134
FGC11134
A551
A551
R1b-L21 Superclade Orientation Panel
R1b-L21 Superclade Orientation Panel
L513
L513
FGC5494
FGC5494
DF21
DF21
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies