Top » Catalog » R1b » A238

$18.00

A238
[A238]

A238
hg38 Position: ChrY:12133957..12133957
Ancestral: C
Derived: T
Reference: A. P. (2014)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Downstream R1b-Z251
Forward Primer: A238v2_F GTTTCTTTCATATGACCAGCATTC
Reverse Primer: A238v2_R ACATGCAATTAGTTATGTGATGACTG
Reviews

Customers who bought this product also purchased
A242
A242
Z251
Z251
A247
A247
A253
A253
R1b-Z251 downstream 24
R1b-Z251 downstream 24
FGC13933
FGC13933
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1174
$18.00
Haplogroup Info
Other products
Currencies