Top » Catalog » R1b » A238

$18.00

A238
[A238]

A238
hg38 Position: ChrY:12133957..12133957
Ancestral: C
Derived: T
Reference: A. P. (2014)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Downstream R1b-Z251
Forward Primer: A238v2_F GTTTCTTTCATATGACCAGCATTC
Reverse Primer: A238v2_R ACATGCAATTAGTTATGTGATGACTG
Reviews

Customers who bought this product also purchased
A251
A251
A256
A256
A244
A244
A250
A250
A255
A255
A243
A243
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A169
1 x A35
1 x A364
$54.00
Haplogroup Info
Other products
Currencies