Top » Catalog » R1b » A241

$18.00

A241
[A241]

A241
hg38 Position: ChrY:6886664..6886664
Ancestral: C
Derived: T
Reference: A. P. (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1j~
Comments: Downstream R1b-Z251
Forward Primer: A241_F TGTGGTACACATCTGTATTTCTAGCTC
Reverse Primer: A241_R GCGATGAGTCAGTTTGATGC
Reviews

Customers who bought this product also purchased
A964
A964
A968
A968
DF13
DF13
FGC11134
FGC11134
A551
A551
R1b-L21 Superclade Orientation Panel
R1b-L21 Superclade Orientation Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies