Top » Catalog » R1b » A242

$18.00

A242
[A242]

A242
hg38 Position: ChrY:7658736..7658736
Ancestral: T
Derived: G
Reference: A. P. (2014)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Downstream R1b-Z251
Forward Primer: A242_F TGGGGTAAGGGTCAAAGGTC
Reverse Primer: A242_R CACAGCACCCTACACCTCAG
Reviews

Customers who bought this product also purchased
A251
A251
A230
A230
A256
A256
A244
A244
A250
A250
A229
A229
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A980
1 x A530
1 x A274
1 x A1263
1 x A883
1 x A275
1 x A252
1 x A598
1 x A511
1 x A2157
$180.00
Haplogroup Info
Other products
Currencies