Top » Catalog » R1b » A243

$18.00

A243
[A243]

A243
hg38 Position: ChrY:7688259..7688259
Ancestral: G
Derived: A
Reference: A. P. (2014)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Downstream R1b-Z251
Forward Primer: A243_F CTGTTGTAGTGTCTGTGGCCAC
Reverse Primer: A243_R TTAGAGAGTAGAGTGGGAAGGGC
Reviews

Customers who bought this product also purchased
A247
A247
R1b-Z251 downstream 24
R1b-Z251 downstream 24
A253
A253
A238
A238
FGC13909
FGC13909
A246
A246
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1338
$18.00
Haplogroup Info
Other products
Currencies