Top » Catalog » R1b » A243

$18.00

A243
[A243]

A243
hg38 Position: ChrY:7688259..7688259
Ancestral: G
Derived: A
Reference: A. P. (2014)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Downstream R1b-Z251
Forward Primer: A243_F CTGTTGTAGTGTCTGTGGCCAC
Reverse Primer: A243_R TTAGAGAGTAGAGTGGGAAGGGC
Reviews

Customers who bought this product also purchased
A246
A246
A252
A252
A232
A232
A458
A458
A245
A245
A251
A251
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies