Top » Catalog » R1b » A243

$18.00

A243
[A243]

A243
hg38 Position: ChrY:7688259..7688259
Ancestral: G
Derived: A
Reference: A. P. (2014)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Downstream R1b-Z251
Forward Primer: A243_F CTGTTGTAGTGTCTGTGGCCAC
Reverse Primer: A243_R TTAGAGAGTAGAGTGGGAAGGGC
Reviews

Customers who bought this product also purchased
A230
A230
A256
A256
A244
A244
A250
A250
A229
A229
A255
A255
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies