Top » Catalog » R1b » A245

$18.00

A245
[A245]

A245
hg38 Position: ChrY:8141298..8141298
Ancestral: G
Derived: A
Reference: A. P. (2014)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Downstream R1b-Z251
Forward Primer: A245_F AAAATTTAATAATAATATTAATGCTTGAAAGGTAC
Reverse Primer: A245_R TAGGTAAGAATTTTAATTTGTTCTGCTTG
Reviews

Customers who bought this product also purchased
A232
A232
A458
A458
A244
A244
A251
A251
A230
A230
A256
A256
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1069
1 x A1318
1 x A1011
$54.00
Haplogroup Info
Other products
Currencies