Top » Catalog » R1b » A245

$18.00

A245
[A245]

A245
hg38 Position: ChrY:8141298..8141298
Ancestral: G
Derived: A
Reference: A. P. (2014)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Downstream R1b-Z251
Forward Primer: A245_F AAAATTTAATAATAATATTAATGCTTGAAAGGTAC
Reverse Primer: A245_R TAGGTAAGAATTTTAATTTGTTCTGCTTG
Reviews

Customers who bought this product also purchased
A238
A238
FGC13909
FGC13909
A246
A246
A252
A252
A232
A232
A458
A458
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies