Top » Catalog » R1b » A246

$19.00

A246
[A246]

A246
hg38 Position: ChrY:9807137..9807137
Ancestral: T
Derived: A
Reference: A. P. (2014)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Downstream R1b-Z251
Forward Primer: A246_F ACTGTTCCACCCTGGACTTG
Reverse Primer: A246_R AGTGCTTCCTGCCATTATGC
Reviews

Customers who bought this product also purchased
R1b-Z251 downstream 24
R1b-Z251 downstream 24
A253
A253
A238
A238
FGC13909
FGC13909
A245
A245
A252
A252
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies