Top » Catalog » R1b » A246

$18.00

A246
[A246]

A246
hg38 Position: ChrY:9807137..9807137
Ancestral: T
Derived: A
Reference: A. P. (2014)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Downstream R1b-Z251
Forward Primer: A246_F ACTGTTCCACCCTGGACTTG
Reverse Primer: A246_R AGTGCTTCCTGCCATTATGC
Reviews

Customers who bought this product also purchased
A248
A248
A228
A228
A254
A254
A241
A241
FGC13933
FGC13933
A247
A247
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies