Top » Catalog » R1b » A248

$18.00

A248
[A248]

A248
hg38 Position: ChrY:10151471..10151471
Ancestral: T
Derived: C
Reference: A. P. (2014)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Downstream R1b-Z251
Forward Primer: A248_F CCTACTGAGTATAAGAACACACTGTGTTG
Reverse Primer: A248_R CCGGTCTGCAAATGTTCAG
Reviews

Customers who bought this product also purchased
A255
A255
A229
A229
Z251
Z251
A242
A242
A247
A247
A254
A254
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2226
1 x A2267
1 x A1056
1 x A746
1 x A792
1 x A1507
1 x A1309
1 x A986
1 x A1302
1 x A450
1 x A715
1 x A2265
1 x A1540
1 x A963
1 x A19
1 x A352
1 x A1324
1 x A2161
1 x A277
1 x A220
1 x A153
$378.00
Haplogroup Info
Other products
Currencies