Top » Catalog » R1b » A250

$18.00

A250
[A250]

A250
hg38 Position: ChrY:13087252..13087252
Ancestral: G
Derived: C
Reference: A. P. (2014)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Downstream R1b-Z251
Forward Primer: A250_F TCCATCATGAGTCATGGTATACATATC
Reverse Primer: A250_R ATATTAATAGATGTTCCAAAATTATATGAGATTC
Reviews

Customers who bought this product also purchased
A244
A244
A251
A251
A230
A230
A256
A256
A243
A243
A248
A248
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1237
1 x A1781
1 x A2138
1 x A2247
1 x A1192
1 x A365
1 x A699
1 x A646
1 x A955
1 x A2134
1 x A674
1 x A2122
1 x A179
1 x A1336
1 x A1771
1 x A1284
1 x A769
$306.00
Haplogroup Info
Other products
Currencies