Top » Catalog » R1b » A251

$18.00

A251
[A251]

A251
hg38 Position: ChrY:13352954..13352954
Ancestral: A
Derived: G
Reference: A. P. (2014)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Downstream R1b-Z251
Forward Primer: A251_F TGAAGGCCAAGGAAAGTAAAAC
Reverse Primer: A251_R GAGGCCTTGAAACCAGGTG
Reviews

Customers who bought this product also purchased
A242
A242
Z251
Z251
A247
A247
A228
A228
A254
A254
A241
A241
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies