Top » Catalog » R1b » A251

$18.00

A251
[A251]

A251
hg38 Position: ChrY:13352954..13352954
Ancestral: A
Derived: G
Reference: A. P. (2014)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Downstream R1b-Z251
Forward Primer: A251_F TGAAGGCCAAGGAAAGTAAAAC
Reverse Primer: A251_R GAGGCCTTGAAACCAGGTG
Reviews

Customers who bought this product also purchased
A253
A253
R1b-Z251 downstream 24
R1b-Z251 downstream 24
FGC13909
FGC13909
A238
A238
A245
A245
A252
A252
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2204
$18.00
Haplogroup Info
Other products
Currencies