Top » Catalog » R1b » A253

$18.00

A253
[A253]

A253
hg38 Position: ChrY:17355297..17355297
Ancestral: G
Derived: A
Reference: A. P. (2014)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Downstream R1b-Z251
Forward Primer: A253_F TGGGGTTAGTTTCCCACAAG
Reverse Primer: A253_R TTTCTCATTACTGGAGGCTTTTC
Reviews

Customers who bought this product also purchased
A246
A246
R1b-Z251 downstream 24
R1b-Z251 downstream 24
A252
A252
A238
A238
FGC13909
FGC13909
A245
A245
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A994
1 x A1718
1 x A948
1 x A294
1 x A995
1 x A2260
$108.00
Haplogroup Info
Other products
Currencies