Top » Catalog » R1b » A253

$18.00

A253
[A253]

A253
hg38 Position: ChrY:17355297..17355297
Ancestral: G
Derived: A
Reference: A. P. (2014)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Downstream R1b-Z251
Forward Primer: A253_F TGGGGTTAGTTTCCCACAAG
Reverse Primer: A253_R TTTCTCATTACTGGAGGCTTTTC
Reviews

Customers who bought this product also purchased
A251
A251
A458
A458
A232
A232
A244
A244
A250
A250
A256
A256
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies