Top » Catalog » R1b » A254

$18.00

A254
[A254]

A254
hg38 Position: ChrY:17451695..17451695
Ancestral: C
Derived: A
Reference: A. P. (2014)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Downstream R1b-Z251
Forward Primer: A254_F ATGGACTCAGGGGAGAAAGG
Reverse Primer: A254_R ATGGTGGCTACTGGGATTTC
Reviews

Customers who bought this product also purchased
A242
A242
Z251
Z251
A247
A247
A228
A228
A253
A253
A241
A241
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1774
1 x A2138
$36.00
Haplogroup Info
Other products
Currencies