Top » Catalog » R1b » A254

$18.00

A254
[A254]

A254
hg38 Position: ChrY:17451695..17451695
Ancestral: C
Derived: A
Reference: A. P. (2014)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Downstream R1b-Z251
Forward Primer: A254_F ATGGACTCAGGGGAGAAAGG
Reverse Primer: A254_R ATGGTGGCTACTGGGATTTC
Reviews

Customers who bought this product also purchased
A238
A238
FGC13909
FGC13909
A245
A245
A251
A251
A232
A232
A458
A458
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies