Top » Catalog » R1b » A255

$18.00

A255
[A255]

A255
hg38 Position: ChrY:18917512..18917512
Ancestral: A
Derived: G
Reference: A. P. (2014)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Downstream R1b-Z251
Forward Primer: A255_F TAAGTCCTGCTCCAGGCATC
Reverse Primer: A255_R GGGCAGGACAATTGGAAG
Reviews

Customers who bought this product also purchased
A248
A248
A254
A254
A229
A229
Z251
Z251
A242
A242
A247
A247
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A567
1 x A1327
1 x A2163
1 x A127
1 x A1787
1 x A1285
1 x A802
1 x A70
1 x A2145
1 x A990
1 x A97
1 x A552
1 x A425
1 x A787
1 x A68
1 x A2120
1 x A614
1 x A117
$324.00
Haplogroup Info
Other products
Currencies