Top » Catalog » R1b » A256

$18.00

A256
[A256]

A256
hg38 Position: ChrY:19338072..19338072
Ancestral: T
Derived: A
Reference: A. P. (2014)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Downstream R1b-Z251
Forward Primer: A256_F TCCACTCCTTGATTGATGGTC
Reverse Primer: A256_R AAGTTAATGGAGGCAGCACAG
Reviews

Customers who bought this product also purchased
A252
A252
A232
A232
FGC13933
FGC13933
A245
A245
A251
A251
A230
A230
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A592
1 x A1174
1 x A33
1 x A2132
1 x A1171
1 x A171
1 x A1292
$126.00
Haplogroup Info
Other products
Currencies