Top » Catalog » R1b » A259

$18.00

A259
[A259]

A259
hg38 Position: ChrY:15557160..15557160
Ancestral: A
Derived: G
Reference: Iain Kennedy (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1a1a1a1a1a3
Comments: Downstream R1b-M222/S660
Forward Primer: A259_F CAAAAATGACCCTGGGCTTC
Reverse Primer: A259_R GGCATCACAGTGTTCAAAATG
Reviews

Customers who bought this product also purchased
FGC59201
FGC59201
FGC19842
FGC19842
FGC30115
FGC30115
FGC19852
FGC19852
A1147
A1147
FGC33214
FGC33214
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A59
1 x A1499
1 x A2210
$54.00
Haplogroup Info
Other products
Currencies